(1) All published data, executables and sources from this site described above apply to GNU General Public License as published by the Free Software Foundation and can not be used, copied, sold, redistributed or used in any other way but only by written permission by Jasenko Dzinleski . Copyright (C) from 2001 - 2013 and later by Jasenko Dzinleski
(2) This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version , if not opposite to (1) .
(3) This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU General Public License for more details .
You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc ., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA .






Protein result from : gi|2370077|emb|Z97054.1| Human DNA sequence from clone RP3-339A18 on chromosome Xp11.1-11.4
Contains the 5' end of the SMC1L1 gene for SMC1 structural maintenance of chromosomes 1-like 1 (yeast),
a novel RIB43A domain containing protein ( FLJ32783),
the HADH2 gene for hydroxyacyl-Coenzyme A dehydrogenase type II,
a novel pseudogene (FLJ20516),
the 3' end of the gene for upstream regulatory element binding protein 1 (UREB1),
a novel gene and three CpG islands, complete sequence





 136 atggcaggtgaaaccagtaagatgtataacataaaacagtcaaca
        M  A  G  E  T  S  K  M  Y  N  I  K  Q  S  T 
    181 gataccaaggaagcagcagccatcgaggctagaagaaatcgagaa
        D  T  K  E  A  A  A  I  E  A  R  R  N  R  E 
    226 aaagagcgacaaaaccgattcttcaatgtgcggaaccgagtcatg
        K  E  R  Q  N  R  F  F  N  V  R  N  R  V  M 
    271 ggtaccagccaggtgcagtatgatgtggtagtccagatgttagag
        G  T  S  Q  V  Q  Y  D  V  V  V  Q  M  L  E 
    316 aaggaagaggcagatcgaacacgtcagctggccaagaaagtccag
        K  E  E  A  D  R  T  R  Q  L  A  K  K  V  Q 
    361 gagtttcgggagcagaagcagcagctcaagaacgggcgtgaattt
        E  F  R  E  Q  K  Q  Q  L  K  N  G  R  E  F 
    406 agtctttgggatccaggccaagtctggaaggggcttccaacctat
        S  L  W  D  P  G  Q  V  W  K  G  L  P  T  Y 
    451 cttagttacagtaatacctatcctggtccagccagcctgcagtac
        L  S  Y  S  N  T  Y  P  G  P  A  S  L  Q  Y 
    496 ttctctggggaagacctagacagggacacacggctgagaatgcag
        F  S  G  E  D  L  D  R  D  T  R  L  R  M  Q 
    541 caggggcagttcaggtacaacttggaaaggcaacagcaggagcaa
        Q  G  Q  F  R  Y  N  L  E  R  Q  Q  Q  E  Q 
    586 cagcaagccaaggttgatgagaattatacagtagatgcgctcagt
        Q  Q  A  K  V  D  E  N  Y  T  V  D  A  L  S 
    631 aaccagctgcgcctcgccatggatgcacaggccacccatctggcc
        N  Q  L  R  L  A  M  D  A  Q  A  T  H  L  A 
    676 aggctggaggagtcctgtcgtgcggccatgatgtgtgccatggcc
        R  L  E  E  S  C  R  A  A  M  M  C  A  M  A 
    721 aacgccaacaaagcgcaggcagctgtgcaggctgggcgtcagcgc
        N  A  N  K  A  Q  A  A  V  Q  A  G  R  Q  R 
    766 tgtgagcgtcagcgtgaacagaaggccaaccttgcggagatccag
        C  E  R  Q  R  E  Q  K  A  N  L  A  E  I  Q 
    811 caccagagcacgagtgacctactgactgaaaacccccaggtcgcc
        H  Q  S  T  S  D  L  L  T  E  N  P  Q  V  A 
    856 caacaccctatggctccctaccgggtcctgccctattgctggaag
        Q  H  P  M  A  P  Y  R  V  L  P  Y  C  W  K 
    901 ggcatgactccagagcagcaagctgccatcaggaaagagcaggaa
        G  M  T  P  E  Q  Q  A  A  I  R  K  E  Q  E 
    946 gtacaacgctctaagaagcaagcacaccgtcaggctgagaaaaca
        V  Q  R  S  K  K  Q  A  H  R  Q  A  E  K  T 
    991 ctggatactgaatggaaaagccagactatgagctcagcccaggca
        L  D  T  E  W  K  S  Q  T  M  S  S  A  Q  A 
   1036 gtgctggagctagaagagcaggagagggaattgtgtgctgtattt
        V  L  E  L  E  E  Q  E  R  E  L  C  A  V  F 
   1081 caaaggggtctaggatccttcaaccagcagctggctaatgagcaa
        Q  R  G  L  G  S  F  N  Q  Q  L  A  N  E  Q 
   1126 aaagcggcaggattacctgaattcagtaatctacaccaatcaacc
        K  A  A  G  L  P  E  F  S  N  L  H  Q  S  T 
   1171 tacagcccagtatcaccagcagtttaa 1197   
        Y  S  P  V  S  P  A  V  * 

  Homo sapiens (man) [primates] taxid 9606
 ref|NP_001026915.1| RIB43A-like with coiled-coils protein ...     587  0.0
 sp|Q8N443.1|RIBC1_HUMAN RecName: Full=RIB43A-like with coi...     587  0.0
 gb|AAH36767.1| RIB43A domain with coiled-coils 1 [Homo sap...     587  0.0
 emb|CAI42650.1| RIB43A domain with coiled-coils 1 [Homo sa...     587  0.0
 gb|EAW93153.1| RIB43A domain with coiled-coils 1, isoform ...     587  0.0
 gb|EAW93154.1| RIB43A domain with coiled-coils 1, isoform ...     587  0.0
 gb|EAW93156.1| RIB43A domain with coiled-coils 1, isoform ...     587  0.0
 dbj|BAF85560.1| unnamed protein product [Homo sapiens]            585  0.0
 ref|NP_001253982.1| RIB43A-like with coiled-coils protein ...     302  2e-98
 dbj|BAG65059.1| unnamed protein product [Homo sapiens]            301  3e-98
 emb|CAI42648.1| RIB43A domain with coiled-coils 1 [Homo sa...     292  1e-95
 ref|NP_659405.1| RIB43A-like with coiled-coils protein 1 i...     291  5e-95
 dbj|BAB71438.1| unnamed protein product [Homo sapiens]            291  5e-95
 emb|CAI42649.1| RIB43A domain with coiled-coils 1 [Homo sa...     291  5e-95
 gb|EAW93152.1| RIB43A domain with coiled-coils 1, isoform ...     291  5e-95
 dbj|BAF83035.1| unnamed protein product [Homo sapiens]            290  3e-94
 gb|EAW73384.1| RIB43A domain with coiled-coils 2 [Homo sap...     139  2e-34
 ref|NP_056468.2| RIB43A-like with coiled-coils protein 2 [...     139  2e-34
 emb|CAG30324.1| dJ102D24.2 [Homo sapiens]                         128  6e-31
 sp|Q9H4K1.1|RIBC2_HUMAN RecName: Full=RIB43A-like with coi...     127  1e-30
 emb|CAC09526.1| hypothetical protein [Homo sapiens]               127  1e-30
 gb|AAH03024.1| RIB43A domain with coiled-coils 2 [Homo sap...     127  1e-30
 gb|AAH09904.1| RIB43A domain with coiled-coils 2 [Homo sap...     127  1e-30
 emb|CAG33679.1| DKFZP566F0546 [Homo sapiens]                      127  1e-30



Protein result from : gi|2085785|gb|AC002086.1|AC002086 Human PAC clone RP3-525N14 from Xq23, complete sequence




  30690 atgaaggcagaaataaagatgttctttgaaaccaacgagaacaaa
        M  K  A  E  I  K  M  F  F  E  T  N  E  N  K 
  30735 gacaaaacataccagaatctctgggacacattcaaaacagtgtgt
        D  K  T  Y  Q  N  L  W  D  T  F  K  T  V  C 
  30780 agagggaaatttatagcactaaatgcccacaagagaaagcaggaa
        R  G  K  F  I  A  L  N  A  H  K  R  K  Q  E 
  30825 agatctaaaattgacaccctaacatcacaattaaaaggacttgag
        R  S  K  I  D  T  L  T  S  Q  L  K  G  L  E 
  30870 aagcaagagcaaacacattcaaaagctagcagaaggcaagaaata
        K  Q  E  Q  T  H  S  K  A  S  R  R  Q  E  I 
  30915 actaagatcagagcagaactgaaggaaatagagacacaaaaaacc
        T  K  I  R  A  E  L  K  E  I  E  T  Q  K  T 
  30960 cttcaaaaaatcaacgaatccaggagctggttttttgaaaagatc
        L  Q  K  I  N  E  S  R  S  W  F  F  E  K  I 
  31005 aacaaaattgatagaccgctagcaagactaataaagaataaaaga
        N  K  I  D  R  P  L  A  R  L  I  K  N  K  R 
  31050 gaggagaatcaaatagacgcaataaaaaatgataaaggggatatc
        E  E  N  Q  I  D  A  I  K  N  D  K  G  D  I 
  31095 accactgatcccacagaaatacaaactgccatcagcgaatactat
        T  T  D  P  T  E  I  Q  T  A  I  S  E  Y  Y 
  31140 aaacacctctacgcaaataaactggaaaatctagaagaaatggat
        K  H  L  Y  A  N  K  L  E  N  L  E  E  M  D 
  31185 aaattcctcgacacctacaccctcccaagactaaaccaggaagaa
        K  F  L  D  T  Y  T  L  P  R  L  N  Q  E  E 
  31230 gttgaatctctgaatagaccaataacaggctctgaaattgaggca
        V  E  S  L  N  R  P  I  T  G  S  E  I  E  A 
  31275 ataattaatagcttaccaaccaaaaaaagtccaggaccagatgga
        I  I  N  S  L  P  T  K  K  S  P  G  P  D  G 
  31320 ttcatggccgaattctaccagagggacaaggaggagctggtacca
        F  M  A  E  F  Y  Q  R  D  K  E  E  L  V  P 
  31365 ttccttctgaaactgttccaatcaatagaaaaagagggaatcctc
        F  L  L  K  L  F  Q  S  I  E  K  E  G  I  L 
  31410 cctaactcattttatgaggccagcatcatgctgataccaaagcct
        P  N  S  F  Y  E  A  S  I  M  L  I  P  K  P 
  31455 ggcagagacacaacaaaaaaagagaattttagaccaatatccctg
        G  R  D  T  T  K  K  E  N  F  R  P  I  S  L 
  31500 atgaacatcgatgcaaaaatcctcaataaaatactggcaaaccga
        M  N  I  D  A  K  I  L  N  K  I  L  A  N  R 
  31545 atccagcagcacatcaaaaagcttatccaccatgatcaagtgggc
        I  Q  Q  H  I  K  K  L  I  H  H  D  Q  V  G 
  31590 ttcatccctgggatgcaaggctggttcaacttacgcaaatcacta
        F  I  P  G  M  Q  G  W  F  N  L  R  K  S  L 
  31635 aacgtaatccagcatataaacagaaccaatgacaaaaaccacatg
        N  V  I  Q  H  I  N  R  T  N  D  K  N  H  M 
  31680 attatctcaatagatgcagaaaaggcctttgacaaaattcaacag
        I  I  S  I  D  A  E  K  A  F  D  K  I  Q  Q 
  31725 cccttcatgctaaaaactctcaataaattaggtattgatgggatg
        P  F  M  L  K  T  L  N  K  L  G  I  D  G  M 
  31770 tatctcaaaataataagagctatctatgacagacccacagccaat
        Y  L  K  I  I  R  A  I  Y  D  R  P  T  A  N 
  31815 atcatactgaatgggcaaaaactggaagcattccctttgaaaact
        I  I  L  N  G  Q  K  L  E  A  F  P  L  K  T 
  31860 ggcacaagacagggatgccctctctcaccactcctattcaatata
        G  T  R  Q  G  C  P  L  S  P  L  L  F  N  I 
  31905 gtgttggaagttctggccagggcaatcaggcaggagaaggaaata
        V  L  E  V  L  A  R  A  I  R  Q  E  K  E  I 
  31950 aagggtattcaattaggaaaagaggaagtcaaattgtccctgttt
        K  G  I  Q  L  G  K  E  E  V  K  L  S  L  F 
  31995 gcagatgacatgactgtatatttagaaaacgccatcgtctcagcc
        A  D  D  M  T  V  Y  L  E  N  A  I  V  S  A 
  32040 ccaaatctccttaagctgataggcaacttcagcaaagtctcagga
        P  N  L  L  K  L  I  G  N  F  S  K  V  S  G 
  32085 tacaaaatcaatgtgcaaaaatcacaagcattcttatacactaat
        Y  K  I  N  V  Q  K  S  Q  A  F  L  Y  T  N 
  32130 aacagacaaacagagagccaaatcatgagtgaactcccattcaga
        N  R  Q  T  E  S  Q  I  M  S  E  L  P  F  R 
  32175 attgcttcaaagagaataaaatacctaggaatccaacttacaagg
        I  A  S  K  R  I  K  Y  L  G  I  Q  L  T  R 
  32220 gatgtgaaggacctcttcaagcagaactacaaaccactgctcaat
        D  V  K  D  L  F  K  Q  N  Y  K  P  L  L  N 
  32265 gaaataaaagaggatacaaacaaatggaagaacattccatgctca
        E  I  K  E  D  T  N  K  W  K  N  I  P  C  S 
  32310 tgggtaggaagaatcaatatcgtgaaaatggccatactgcccaag
        W  V  G  R  I  N  I  V  K  M  A  I  L  P  K 
  32355 gtaatttatagattcaatgccatccccatcaagctactaatgact
        V  I  Y  R  F  N  A  I  P  I  K  L  L  M  T 
  32400 ttcttcacagaattggaaaaaactactttaaagttcatatggaac
        F  F  T  E  L  E  K  T  T  L  K  F  I  W  N 
  32445 caaaaaagagcttgcattgccaagtcaatcctaagccaaaagaac
        Q  K  R  A  C  I  A  K  S  I  L  S  Q  K  N 
  32490 aaagctggaggcatcatgctacctgacttcaaactatactacaag
        K  A  G  G  I  M  L  P  D  F  K  L  Y  Y  K 
  32535 gctacagtaatcaaaacagcatggtactggtaccaaaacagagat
        A  T  V  I  K  T  A  W  Y  W  Y  Q  N  R  D 
  32580 atagaccaatggaacagaacagagtcctcagaaataatgccgctt
        I  D  Q  W  N  R  T  E  S  S  E  I  M  P  L 
  32625 atctacaactatctgatctttgacaaacctgacaaaaacaagaaa
        I  Y  N  Y  L  I  F  D  K  P  D  K  N  K  K 
  32670 tggggaaaggattccctatttaataaatggtgctgggaaaactgg
        W  G  K  D  S  L  F  N  K  W  C  W  E  N  W 
  32715 cttgccatatgtagaaagctgaaactggatcccttccttacgcct
        L  A  I  C  R  K  L  K  L  D  P  F  L  T  P 
  32760 tatataaaaattaattcaagatggattaaagacttaaatgttaga
        Y  I  K  I  N  S  R  W  I  K  D  L  N  V  R 
  32805 cctaaaaccataaaaaccctagaagaaaaccaggcaataccattc
        P  K  T  I  K  T  L  E  E  N  Q  A  I  P  F 
  32850 aggacatag 32858  
        R  T  * 

  Helicobacter pylori Hp P-4 [e-proteobacteria] taxid 992075
 gb|EJB99260.1| retrovirus-related Pol polyprotein LINE-1 [...    1384  0.0

  Homo sapiens (man) [primates] taxid 9606
 pir||B34087 hypothetical protein (L1H 3' region) - human         1384  0.0
 gb|AAC51261.1| putative p150 [Homo sapiens]                      1376  0.0
 gb|AAD38785.1|AF149422_2 unknown [Homo sapiens]                  1372  0.0
 gb|AER41895.1| unknown [Homo sapiens]                            1371  0.0
 gb|AAD39215.1|AF148856_2 unknown [Homo sapiens]                  1371  0.0
 pir||S65824 reverse transcriptase homolog - human transpos...    1371  0.0
 gb|AAA51622.1| ORF2 [Homo sapiens]                               1371  0.0
 gb|AAL50637.1| unknown [Homo sapiens]                            1370  0.0
 gb|AAC51264.1| putative p150 [Homo sapiens]                      1370  0.0
 gb|AAC51271.1| putative p150 [Homo sapiens]                      1370  0.0
 gb|AAC51267.1| putative p150 [Homo sapiens]                      1367  0.0
 gb|AAC51276.1| putative p150 [Homo sapiens]                      1366  0.0
 gb|AAB59368.1| ORF2 contains a reverse transcriptase domai...    1364  0.0
 gb|AAA88037.1| unknown protein, partial [Homo sapiens]           1364  0.0
 gb|AAC51279.1| putative p150 [Homo sapiens]                      1363  0.0
 pir||I38588 reverse transcriptase homolog - human retrotra...    1359  0.0
 gb|AAB60345.1| ORF2 [Homo sapiens]                               1359  0.0
 gb|AAC51263.1| putative p150 [Homo sapiens]                      1359  0.0
 gb|AAC51269.1| putative p150 [Homo sapiens]                      1357  0.0
 prf||1207289A reverse transcriptase related protein              1357  0.0
 gb|AAC51273.1| putative p150 [Homo sapiens]                      1349  0.0
 gb|AAD04635.1| ORF2-like protein [Homo sapiens]                   957  0.0
 prf||1510254A L1 repetitive element ORF                           855  0.0
 emb|CAA36480.1| unnamed protein product [Homo sapiens]            784  0.0
 gb|AAG27485.1|AF194537_1 NAG13 [Homo sapiens]                     767  0.0
 gb|AAA88038.1| unknown protein, partial [Homo sapiens]            670  0.0
 gb|AAH36758.1| MGC4836 protein [Homo sapiens]                     601  0.0
 gb|AAW63045.1| reverse transcriptase-like protein [Homo sa...     462  2e-155
 dbj|BAC04627.1| unnamed protein product [Homo sapiens]            379  4e-124



Where the following sequence : CCACCATGATCAAGTGGGCTTCATCCCTGGGATGC corresponds to :

NM_001190882.2 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 6, mRNA
NM_001190879.2 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 4, mRNA
NM_002552.4 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 2, mRNA
NM_001190881.2 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 5, mRNA
NM_181741.3 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 1, mRNA
NM_181742.3 Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 3, mRNA
XR_109938.1 PREDICTED: Homo sapiens hypothetical LOC100129434 (LOC100129434), miscRNA

Ref: PMCID: PMC357046
Identification of a human NF-kB-activating protein, TAB3 Published online 2004 February 6. doi: 10.1073/pnas.0307314101




Where the following sequence :
caatatccctgatgaacatcgatgcaaaaatcctc
aataaaatactggcaaaccgaatccagcagcacat
caaaaagcttatccaccatgatcaagtgggcttca
tccctgggatgcaaggctggttca
corresponds to :

XR_109938.1 PREDICTED: Homo sapiens hypothetical LOC100129434 (LOC100129434), miscRNA

Ref: PMCID: PMC3140055
Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies Nat Genet. 2010 December, 42(12): 1077-1085. doi: 10.1038/ng.714




Protein result from : gi|3550040|emb|AL031178.1| Human DNA sequence from clone RP3-341E18 on chromosome 6p11.2-12.3 Contains the KIAA0936 gene for a MAK-related kinase, a novel gene for NY-REN-57 antigen and CpG islands, complete sequence




   4558 atgagatatatgctccctaactcattttatgaggacagcatcatt
        M  R  Y  M  L  P  N  S  F  Y  E  D  S  I  I 
   4603 ctgataccaaagccgggcagagacacaaccaaaaaagataatttt
        L  I  P  K  P  G  R  D  T  T  K  K  D  N  F 
   4648 agaccaatatccttgatgaacattgatgcaaaaatcctcaataaa
        R  P  I  S  L  M  N  I  D  A  K  I  L  N  K 
   4693 atactggcaaaccgaatccagcagcatatcaaaaagcttatccac
        I  L  A  N  R  I  Q  Q  H  I  K  K  L  I  H 
   4738 catgatcaagtgggcttcatcgctgggatgcaaggctggttcaat
        H  D  Q  V  G  F  I  A  G  M  Q  G  W  F  N 
   4783 atacgcaaatcaataaatgtcatccagcatataaacagagccaaa
        I  R  K  S  I  N  V  I  Q  H  I  N  R  A  K 
   4828 gacaaaaaccacatgattatctcaatagatgcagaaaaagccttt
        D  K  N  H  M  I  I  S  I  D  A  E  K  A  F 
   4873 gacaaaattcaacaacccttcatgctaaaaactctcaataaatta
        D  K  I  Q  Q  P  F  M  L  K  T  L  N  K  L 
   4918 ggtattgatgggacatatttcaaaataataagagctatctatgac
        G  I  D  G  T  Y  F  K  I  I  R  A  I  Y  D 
   4963 aaacccatagccaatatcatactgaatgggcaaaaactggaagca
        K  P  I  A  N  I  I  L  N  G  Q  K  L  E  A 
   5008 ttccctttgaaaactggcacaagacagggatgccctctctcaccg
        F  P  L  K  T  G  T  R  Q  G  C  P  L  S  P 
   5053 ctcctattcaacatagtgttggaagttctggcctgggcaatcagg
        L  L  F  N  I  V  L  E  V  L  A  W  A  I  R 
   5098 caggagaaggaaataaagggtattcaattaggaaaatcttcaaaa
        Q  E  K  E  I  K  G  I  Q  L  G  K  S  S  K 
   5143 tacattaggtaa 5154   
        Y  I  R  * 

  Homo sapiens (man) [primates] taxid 9606
 gb|AAG27485.1|AF194537_1 NAG13 [Homo sapiens]                     365  3e-123
 gb|AAD04635.1| ORF2-like protein [Homo sapiens]                   369  2e-122
 gb|AAC51279.1| putative p150 [Homo sapiens]                       373  6e-118
 gb|AAL50637.1| unknown [Homo sapiens]                             373  7e-118
 gb|AER41895.1| unknown [Homo sapiens]                             373  7e-118
 gb|AAD39215.1|AF148856_2 unknown [Homo sapiens]                   373  8e-118
 pir||I38588 reverse transcriptase homolog - human retrotra...     373  8e-118
 gb|AAB60345.1| ORF2 [Homo sapiens]                                373  8e-118
 gb|AAD38785.1|AF149422_2 unknown [Homo sapiens]                   373  8e-118
 gb|AAC51267.1| putative p150 [Homo sapiens]                       373  8e-118
 gb|AAA88037.1| unknown protein, partial [Homo sapiens]            370  2e-117
 gb|AAC51269.1| putative p150 [Homo sapiens]                       372  2e-117
 pir||S65824 reverse transcriptase homolog - human transpos...     371  4e-117
 gb|AAA51622.1| ORF2 [Homo sapiens]                                371  4e-117
 gb|AAB59368.1| ORF2 contains a reverse transcriptase domai...     371  4e-117
 gb|AAC51276.1| putative p150 [Homo sapiens]                       370  5e-117
 gb|AAC51264.1| putative p150 [Homo sapiens]                       370  6e-117
 gb|AAC51261.1| putative p150 [Homo sapiens]                       370  8e-117
 gb|AAC51263.1| putative p150 [Homo sapiens]                       369  2e-116
 gb|AAC51271.1| putative p150 [Homo sapiens]                       366  2e-115
 pir||B34087 hypothetical protein (L1H 3' region) - human          366  3e-115
 gb|AAC51273.1| putative p150 [Homo sapiens]                       361  1e-113
 prf||1207289A reverse transcriptase related protein               360  4e-113
 prf||1510254A L1 repetitive element ORF                           317  2e-102
 gb|EAX05005.1| hCG1820778 [Homo sapiens]                          300  3e-101
 emb|CAA36480.1| unnamed protein product [Homo sapiens]            248  1e-74
 emb|CAR63175.1| hypothetical protein [Homo sapiens]               226  3e-72
 emb|CAA26918.1| unnamed protein product [Homo sapiens]            217  5e-69
 dbj|BAC87159.1| unnamed protein product [Homo sapiens]            177  2e-53
 gb|AAH36758.1| MGC4836 protein [Homo sapiens]                     149  3e-40






     39 atgacattagcatatggagattccatgctgtgtagaccagagatg
        M  T  L  A  Y  G  D  S  M  L  C  R  P  E  M 
     84 gcacactggcaatggtgccattcactattgaagcacaccctgaaa
        A  H  W  Q  W  C  H  S  L  L  K  H  T  L  K 
    129 ctccactcactgggaaatgcacaactccagatgttccgagctcag
        L  H  S  L  G  N  A  Q  L  Q  M  F  R  A  Q 
    174 tggatgtttgaacttgctccaggtgtaagctctagcaatttagaa
        W  M  F  E  L  A  P  G  V  S  S  S  N  L  E 
    219 aatcgaccttgcagagcagcaagaggctctctccagaaaacatcg
        N  R  P  C  R  A  A  R  G  S  L  Q  K  T  S 
    264 gcagataccaaaggaaaacaagaacaggcaaaagaagaaaacatt
        A  D  T  K  G  K  Q  E  Q  A  K  E  E  N  I 
    309 gaagataatgatgatgacagcaaaatggcagatctcttgtcctac
        E  D  N  D  D  D  S  K  M  A  D  L  L  S  Y 
    354 ttccagcagcaactcacatttcaggagtctgtgcttaaactgtgt
        F  Q  Q  Q  L  T  F  Q  E  S  V  L  K  L  C 
    399 cagcctgagcttgagagcagtcagattcacatatcagtgctgcca
        Q  P  E  L  E  S  S  Q  I  H  I  S  V  L  P 
    444 atggaggtcctgatgtacatcttccgatgggtggtgtctagtgac
        M  E  V  L  M  Y  I  F  R  W  V  V  S  S  D 
    489 ttggacctcagatcattggagcagttgtcgctggtgtgcagagga
        L  D  L  R  S  L  E  Q  L  S  L  V  C  R  G 
    534 ttctacatctgtgccagagaccctgaaatatggcgtctggcctgc
        F  Y  I  C  A  R  D  P  E  I  W  R  L  A  C 
    579 ttgaaagtttggggcagaagctgtattaaacttgttccgtacacg
        L  K  V  W  G  R  S  C  I  K  L  V  P  Y  T 
    624 tcctggagagagatgtttttagaacggcctcgtgttcggtttgat
        S  W  R  E  M  F  L  E  R  P  R  V  R  F  D 
    669 ggtacataa 677    
        G  T  * 

  Homo sapiens (man) [primates] taxid 9606
 gb|AAD42880.1|AF155114_1 NY-REN-57 antigen [Homo sapiens]         340  9e-113
 ref|NP_258441.1| F-box only protein 9 isoform 2 [Homo sapi...     339  2e-112
 emb|CAB70786.2| hypothetical protein [Homo sapiens]               339  2e-112
 emb|CAI20262.1| F-box protein 9 [Homo sapiens]                    339  2e-112
 gb|AAW51115.1| cross-immune reaction antigen [Homo sapiens]       339  2e-112
 dbj|BAG51038.1| unnamed protein product [Homo sapiens]            339  2e-112
 ref|NP_036479.1| F-box only protein 9 isoform 1 [Homo sapi...     338  7e-112
 sp|Q9UK97.1|FBX9_HUMAN RecName: Full=F-box only protein 9;...     338  7e-112
 gb|AAF03704.1| F-box protein FBX9 [Homo sapiens]                  338  7e-112
 emb|CAI20263.1| F-box protein 9 [Homo sapiens]                    338  7e-112
 dbj|BAD93070.1| F-box only protein 9 isoform 2 variant [Ho...     339  5e-111
 ref|NP_258442.2| F-box only protein 9 isoform 3 [Homo sapi...     332  4e-110
 gb|AAH00650.2| F-box protein 9 [Homo sapiens]                     332  4e-110
 gb|EAX04408.1| F-box protein 9, isoform CRA_b [Homo sapiens]      253  6e-82
 gb|EAX04409.1| F-box protein 9, isoform CRA_b [Homo sapiens]      253  6e-82
 gb|AAF04518.1|AF174597_1 F-box protein Fbx9 [Homo sapiens]        257  8e-82
 gb|EAX04405.1| F-box protein 9, isoform CRA_a [Homo sapiens]      257  8e-82
 gb|EAX04406.1| F-box protein 9, isoform CRA_a [Homo sapiens]      257  8e-82
 gb|EAX04407.1| F-box protein 9, isoform CRA_a [Homo sapiens]      257  8e-82

Ref: PMCID: PMC2876993
The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors
Thomas W Sturgill,corresponding author Paul B Stoddard, Steven M Cohn, and Marty W Mayo

Mol Cancer. 2010; 9: 104. doi: 10.1186/1476-4598-9-104




A single probe N01__normal.CEL (from prostate normal datasets) was examined from gi|4456457|emb|Z99716.4| Human DNA sequence from clone CTA-250D10 on chromosome 22 , and gi|1869809|emb|X99656.1| H.sapiens mRNA for protein containing SH3 domain .
Blast queries on : NT_011520.12 (chr22) , NT_011255.14 (chr19) , NT_010783.15 (chr17) , (selected) results in Blast Results (04.08.2012) and bellow




   1894 atgtttttgcttaagaaagtactagaacactaccactattccaat
        M  F  L  L  K  K  V  L  E  H  Y  H  Y  S  N 
   1939 aattacacctttatcttatcaatgtggcgcagacggggaagcgga
        N  Y  T  F  I  L  S  M  W  R  R  R  G  S  G 
   1984 gccaacatgccagtggcccggagctgggtttgtcgcaaaacttat
        A  N  M  P  V  A  R  S  W  V  C  R  K  T  Y 
   2029 gtgaccccgcggagacccttcgagaaatctcgtctcgaccaagag
        V  T  P  R  R  P  F  E  K  S  R  L  D  Q  E 
   2074 ctgaagctgatcggcgagtatgggctccggaacaaacgtgaggtc
        L  K  L  I  G  E  Y  G  L  R  N  K  R  E  V 
   2119 tggagggtcaaatttaccctggccaagatccgcaaggccgcccgg
        W  R  V  K  F  T  L  A  K  I  R  K  A  A  R 
   2164 gaactgctgacgcttgatgagaaggacccacggcgtctgttcgaa
        E  L  L  T  L  D  E  K  D  P  R  R  L  F  E 
   2209 ggcaacgccctgctgcggcggctggtccgcattggggtgctggat
        G  N  A  L  L  R  R  L  V  R  I  G  V  L  D 
   2254 gagggcaagatgaagctggattacatcctgggcctgaagatagag
        E  G  K  M  K  L  D  Y  I  L  G  L  K  I  E 
   2299 gatttcttagagagacgcctgcagacccaggtcttcaagctgggc
        D  F  L  E  R  R  L  Q  T  Q  V  F  K  L  G 
   2344 ttggccaagtccatccaccacgctcgcgtgctgatccgccagcgc
        L  A  K  S  I  H  H  A  R  V  L  I  R  Q  R 
   2389 catatcagggtccgcaagcaggtggtgaacatcccgtccttcatt
        H  I  R  V  R  K  Q  V  V  N  I  P  S  F  I 
   2434 gtccgcctggattcccagaagcacatcgacttctctctgcgctct
        V  R  L  D  S  Q  K  H  I  D  F  S  L  R  S 
   2479 ccctacgggggtggccgcccgggccgcgtgaagaggaagaatgcc
        P  Y  G  G  G  R  P  G  R  V  K  R  K  N  A 
   2524 aagaagggccagggtggggctggggctggagacgacgaggaggag
        K  K  G  Q  G  G  A  G  A  G  D  D  E  E  E 
   2569 gattaa 2574   
        D  * 



  synthetic construct [other sequences] taxid 32630
 gb|AAX29348.1| ribosomal protein S9 [synthetic construct]         389  2e-135
 gb|AAX32747.1| ribosomal protein S9 [synthetic construct]         389  2e-135
 gb|ABM82126.1| ribosomal protein S9 [synthetic construct]         389  2e-135
 gb|ABM85309.1| ribosomal protein S9 [synthetic construct]         389  2e-135
 dbj|BAG73682.1| ribosomal protein S9 [synthetic construct]        389  2e-135

  Homo sapiens (man) [primates] taxid 9606
 ref|NP_001004.2| 40S ribosomal protein S9 [Homo sapiens]          389  2e-135
 sp|P46781.3|RS9_HUMAN RecName: Full=40S ribosomal protein S9      389  2e-135
 gb|AAH00802.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|AAH07410.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|AAH07434.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|AAH07857.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 dbj|BAB79477.1| ribosomal protein S9 [Homo sapiens]               389  2e-135
 gb|AAH68055.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|AAH71940.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|AAH96756.1| Ribosomal protein S9 [Homo sapiens]                389  2e-135
 gb|EAW72209.1| ribosomal protein S9, isoform CRA_a [Homo s...     389  2e-135
 gb|EAW72211.1| ribosomal protein S9, isoform CRA_a [Homo s...     389  2e-135
 emb|CAP19125.1| ribosomal protein S9 [Homo sapiens]               389  2e-135
 emb|CAQ09597.1| ribosomal protein S9 [Homo sapiens]               389  2e-135
 gb|AAA85659.1| ribosomal protein S9 [Homo sapiens]                382  1e-132
 prf||2113200F ribosomal protein S9                                382  1e-132
 gb|EAW60406.1| hCG41114, isoform CRA_c [Homo sapiens]             341  2e-116



     40 atggatctgagcttctcctggcattccctacctcctctggcctcc
        M  D  L  S  F  S  W  H  S  L  P  P  L  A  S 
     85 cggggggccagccaccccctagaggagccccaggcttctgattcc
        R  G  A  S  H  P  L  E  E  P  Q  A  S  D  S 
    130 aaggtcgggttttcttccatggcccaggctgggctgtctctagtg
        K  V  G  F  S  S  M  A  Q  A  G  L  S  L  V 
    175 gccaccaggcagatgccttccgccggctggggctgcccccaccta
        A  T  R  Q  M  P  S  A  G  W  G  C  P  H  L 
    220 aagccagccccagccccagggctgccagggccaggaagtggatac
        K  P  A  P  A  P  G  L  P  G  P  G  S  G  Y 
    265 agaagtagatggaggcccagtaccgaagggtgtcggccaaggaga
        R  S  R  W  R  P  S  T  E  G  C  R  P  R  R 
    310 gcagcacgaagcccatgcacatgtagtcataggcgcgcatcttca
        A  A  R  S  P  C  T  C  S  H  R  R  A  S  S 
    355 ggaaccagtgcacccagtcccaggccttctggccccctgggctca
        G  T  S  A  P  S  P  R  P  S  G  P  L  G  S 
    400 gccgcccccgcagggctgactccagccggccctcggcagaggatg
        A  A  P  A  G  L  T  P  A  G  P  R  Q  R  M 
    445 ctggtggtggaggtggcgaacggccgctccctggtgtggggagcc
        L  V  V  E  V  A  N  G  R  S  L  V  W  G  A 
    490 gaggcggtgcaggccctccgggagcgcctgggtgtggggggccgc
        E  A  V  Q  A  L  R  E  R  L  G  V  G  G  R 
    535 acggtaggcgccctgccccgcgggccccgccagaactcgcgcctg
        T  V  G  A  L  P  R  G  P  R  Q  N  S  R  L 
    580 ggcctcccgctgctgctgatgcccgaagaggcgcggctcttggcc
        G  L  P  L  L  L  M  P  E  E  A  R  L  L  A 
    625 gagatcggcgccgtgactctggtcagcgccccgcgtccagactct
        E  I  G  A  V  T  L  V  S  A  P  R  P  D  S 
    670 cggcaccacagcctggtgaccccctccgcttccacgcccattata
        R  H  H  S  L  V  T  P  S  A  S  T  P  I  I 
    715 tcgctcagtgctgggcccccgaggacaccatcccactccaagacc
        S  L  S  A  G  P  P  R  T  P  S  H  S  K  T 
    760 tggttgctgctgggcgccttggaaccagcgtcagaaagaccctgc
        W  L  L  L  G  A  L  E  P  A  S  E  R  P  C 
    805 tcctctgttctccgcagcctgatggtaaggtggtctacacctccc
        S  S  V  L  R  S  L  M  V  R  W  S  T  P  P 
    850 tgcaatgggccagcctgcagtgaactccagagacctaggggatgt
        C  N  G  P  A  C  S  E  L  Q  R  P  R  G  C 
    895 ggctgtgtcggcagcaagagcctttctggatgttccccagctctt
        G  C  V  G  S  K  S  L  S  G  C  S  P  A  L 
    940 ctctgggagtctagaacatcctcctacctttctccgcggttagtt
        L  W  E  S  R  T  S  S  Y  L  S  P  R  L  V 
    985 tttgattccaggttttcgaacactacatcttttttatgttcttcc
        F  D  S  R  F  S  N  T  T  S  F  L  C  S  S 
   1030 ttgtttcaaagcacttattggctgtgtttttgtagttacctattt
        L  F  Q  S  T  Y  W  L  C  F  C  S  Y  L  F 
   1075 tcacactgtgagcttcccgagaatggggcctgggtttga 1113   
        S  H  C  E  L  P  E  N  G  A  W  V  * 



  synthetic construct [other sequences] taxid 32630
 gb|ABM84262.1| tRNA splicing endonuclease 34 homolog (S. c...     258  2e-79
 gb|ABM87651.1| tRNA splicing endonuclease 34 homolog (S. c...     258  2e-79
 gb|ABM84262.1| tRNA splicing endonuclease 34 homolog (S. c...     160  4e-42
 gb|ABM87651.1| tRNA splicing endonuclease 34 homolog (S. c...     160  4e-42

  Homo sapiens (man) [primates] taxid 9606
 emb|CAP19123.2| tRNA splicing endonuclease 34 homolog (S. ...     165  3e-45
 emb|CAQ09594.1| tRNA splicing endonuclease 34 homolog (S. ...     165  4e-45
 emb|CAQ09595.1| tRNA splicing endonuclease 34 homolog (S. ...     163  1e-44
 emb|CAQ06861.1| tRNA splicing endonuclease 34 homolog (S. ...     163  1e-44
 gb|EAW72204.1| tRNA splicing endonuclease 34 homolog (S. c...     164  5e-44
 dbj|BAG61863.1| unnamed protein product [Homo sapiens]            162  2e-43
 ref|NP_076980.2| tRNA-splicing endonuclease subunit Sen34 ...     162  2e-43
 ref|NP_001070914.1| tRNA-splicing endonuclease subunit Sen...     162  2e-43
 sp|Q9BSV6.1|SEN34_HUMAN RecName: Full=tRNA-splicing endonu...     162  2e-43
 gb|AAH04530.1| TSEN34 protein [Homo sapiens]                      162  2e-43
 gb|AAH20805.1| TRNA splicing endonuclease 34 homolog (S. c...     162  2e-43
 gb|EAW72203.1| tRNA splicing endonuclease 34 homolog (S. c...     162  2e-43
 gb|EAW72205.1| tRNA splicing endonuclease 34 homolog (S. c...     162  2e-43
 gb|EAW72207.1| tRNA splicing endonuclease 34 homolog (S. c...     162  2e-43
 emb|CAP19124.1| tRNA splicing endonuclease 34 homolog (S. ...     162  2e-43
 emb|CAQ09596.1| tRNA splicing endonuclease 34 homolog (S. ...     162  2e-43
 dbj|BAB15284.1| unnamed protein product [Homo sapiens]            161  5e-43


     51 atggcggacaagcgcaaactccaaggtgagattgatcgctgcctc
        M  A  D  K  R  K  L  Q  G  E  I  D  R  C  L 
     96 aagaaggtgtccgagggcgtggagcagtttgaagatatttggcag
        K  K  V  S  E  G  V  E  Q  F  E  D  I  W  Q 
    141 aagcaaatggaacggttcaaagttgtggaacgagagaccaaaacc
        K  Q  M  E  R  F  K  V  V  E  R  E  T  K  T 
    186 aaagcttacagcaaagagggcctgggcctggcccagaaggtagat
        K  A  Y  S  K  E  G  L  G  L  A  Q  K  V  D 
    231 cctgcccagaaggagaaggaagaggttggccagtggctcacgaag
        P  A  Q  K  E  K  E  E  V  G  Q  W  L  T  K 
    276 caggaccggattgagggcttgaagcggcacatcgagaagcaccgc
        Q  D  R  I  E  G  L  K  R  H  I  E  K  H  R 
    321 taccacgtgcgcatgctagagaccatcctgcgcatgctggacaat
        Y  H  V  R  M  L  E  T  I  L  R  M  L  D  N 
    366 gactccatcctcgttgacgccatccgcaagatcaaggacgacgtt
        D  S  I  L  V  D  A  I  R  K  I  K  D  D  V 
    411 gagtactatgttgactcatcccaggaccccgacttcgaggagaac
        E  Y  Y  V  D  S  S  Q  D  P  D  F  E  E  N 
    456 gagtttctctacgatgacctggacctcgaggacattccacaggcg
        E  F  L  Y  D  D  L  D  L  E  D  I  P  Q  A 
    501 ctggtcgccacctcccctcccagccacagccacatggaggatgag
        L  V  A  T  S  P  P  S  H  S  H  M  E  D  E 
    546 atcttcaaccagtccagcagcacgcccacctcaaccacctccagc
        I  F  N  Q  S  S  S  T  P  T  S  T  T  S  S 
    591 tctcccatcccgcccagcccagccaactgtaccacggaaaactct
        S  P  I  P  P  S  P  A  N  C  T  T  E  N  S 
    636 gaagatgataagaagaggggacgttccacagacagtgaagtcagc
        E  D  D  K  K  R  G  R  S  T  D  S  E  V  S 
    681 cagtctccagccaaaaacggctccaagcctgtccacagcaaccag
        Q  S  P  A  K  N  G  S  K  P  V  H  S  N  Q 
    726 caccctcagtccccagctgtgccgcccacctacccctccggcccc
        H  P  Q  S  P  A  V  P  P  T  Y  P  S  G  P 
    771 ccgcctgctgcctctgccttgagcaccactcctggcaacaatggg
        P  P  A  A  S  A  L  S  T  T  P  G  N  N  G 
    816 gtccccgcccccgcagcacccccaagtgccctgggccccaaggcc
        V  P  A  P  A  A  P  P  S  A  L  G  P  K  A 
    861 agtccagctcccagccacaactcgggcacccctgctccctatgcc
        S  P  A  P  S  H  N  S  G  T  P  A  P  Y  A 
    906 caggctgtggccccaccagctcccagtgggcccagcacgacccag
        Q  A  V  A  P  P  A  P  S  G  P  S  T  T  Q 
    951 ccccggccccccagcgtccagcctagcggaggcggaggcggcggc
        P  R  P  P  S  V  Q  P  S  G  G  G  G  G  G 
    996 agcggaggtggagggagcagcagcagtagtaacagcagtgccggt
        S  G  G  G  G  S  S  S  S  S  N  S  S  A  G 
   1041 ggaggggctggcaagcagaatggcgccaccaacatcatcctgagc
        G  G  A  G  K  Q  N  G  A  T  N  I  I  L  S 
   1086 agtacatcagcacctccggcctcagcccagccgcccctgcagctg
        S  T  S  A  P  P  A  S  A  Q  P  P  L  Q  L 
   1131 tcagaggtgaacataccgctgtcgctgggtgtctgtccactgggc
        S  E  V  N  I  P  L  S  L  G  V  C  P  L  G 
   1176 cctgtgcccctcaccaaggagcagctctatcagcaggccatggaa
        P  V  P  L  T  K  E  Q  L  Y  Q  Q  A  M  E 
   1221 gaggccgcctggcaccacatgcctcacccctctgactctgagcgt
        E  A  A  W  H  H  M  P  H  P  S  D  S  E  R 
   1266 attcgccccctaccaccaccagatgccacccccacactcggacac
        I  R  P  L  P  P  P  D  A  T  P  T  L  G  H 
   1311 tgtggaattctaccagcgcctgtcgaccgagaggggctgggccgg
        C  G  I  L  P  A  P  V  D  R  E  G  L  G  R 
   1356 gcggggggccccctcgccctgggggtagctggtaccaagggggtt
        A  G  G  P  L  A  L  G  V  A  G  T  K  G  V 
   1401 gagtctgtgcctccgctgcactctggcccaggtatgtcaggatgc
        E  S  V  P  P  L  H  S  G  P  G  M  S  G  C 
   1446 ccagagctttctcttgcctctcctgagggggccaggaaatacaag
        P  E  L  S  L  A  S  P  E  G  A  R  K  Y  K 
   1491 agatgtgatataatctttcaaggtgtcaggtgtgtgccacagccg
        R  C  D  I  I  F  Q  G  V  R  C  V  P  Q  P 
   1536 gctgatttaaatttttaa 1553   
        A  D  L  N  F  * 



  Otolemur garnettii [primates] taxid 30611
 ref|XP_003801622.1| PREDICTED: CCR4-NOT transcription comp...     524  8e-176
 ref|XP_003801623.1| PREDICTED: CCR4-NOT transcription comp...     521  3e-175
 gb|ACH53093.1| CCR4-NOT transcription complex, subunit 3 (...     520  4e-174

  Sorex araneus (Eurasian shrew) [insectivores] taxid 42254
 gb|ACE79079.1| CCR4-NOT transcription complex subunit 3 (p...     506  6e-169

  Cavia porcellus (guinea pig) [rodents] taxid 10141
 ref|XP_003465501.1| PREDICTED: CCR4-NOT transcription comp...     506  1e-168

  Homo sapiens (man) [primates] taxid 9606
 gb|AAF29828.1|AF180474_1 Not3p [Homo sapiens]                     498  1e-167
 ref|NP_055331.1| CCR4-NOT transcription complex subunit 3 ...     496  7e-165
 sp|O75175.1|CNOT3_HUMAN RecName: Full=CCR4-NOT transcripti...     496  7e-165
 gb|AAH16474.1| CCR4-NOT transcription complex, subunit 3 [...     496  7e-165
 gb|EAW72192.1| CCR4-NOT transcription complex, subunit 3, ...     496  7e-165
 gb|EAW72194.1| CCR4-NOT transcription complex, subunit 3, ...     496  7e-165
 ref|NP_055331.1| CCR4-NOT transcription complex subunit 3 ...     143  1e-33
 sp|O75175.1|CNOT3_HUMAN RecName: Full=CCR4-NOT transcripti...     143  1e-33
 gb|AAH16474.1| CCR4-NOT transcription complex, subunit 3 [...     143  1e-33
 gb|EAW72192.1| CCR4-NOT transcription complex, subunit 3, ...     143  1e-33
 gb|EAW72194.1| CCR4-NOT transcription complex, subunit 3, ...     143  1e-33
 dbj|BAA31666.2| KIAA0691 protein [Homo sapiens]                   496  1e-164
 dbj|BAH13283.1| unnamed protein product [Homo sapiens]            493  3e-164
 gb|EAW72193.1| CCR4-NOT transcription complex, subunit 3, ...     494  4e-164
 dbj|BAD18729.1| FLJ00420 protein [Homo sapiens]                   459  3e-152
 emb|CAB63766.1| hypothetical protein [Homo sapiens]               344  2e-108



Ref: PMCID: PMC312835
The yeast SAS (something about silencing) protein complex contains a MYST-type putative acetyltransferase and functions with chromatin assembly factor ASF1
Shigehiro Osada, Ann Sutton, Nemone Muster, Christine E. Brown, John R. Yates, Rolf Sternglanz, and Jerry L. Workman
Genes Dev. 2001 December 1; 15(23): 3155 - 3168. doi: 10.1101/gad.907201



Ref: PMCID: PMC2833189
Silencing of Ribosomal Protein S9 Elicits a Multitude of Cellular Responses Inhibiting the Growth of Cancer Cells Subsequent to p53 Activation
Mikael S. Lindstrom and Monica Nister
PLoS One. 2010; 5(3): e9578 doi: 10.1371




Lung small cell carcinoma and their intensity values from 20 probes :









   4311 atgaagcctcagtttccagcgaccgcgtcactcggctcaaactct
        M  K  P  Q  F  P  A  T  A  S  L  G  S  N  S 
   4356 gggatctggaacatgctctgggctgtgaggacaagatgttacgta
        G  I  W  N  M  L  W  A  V  R  T  R  C  Y  V 
   4401 gtcaaggcacagctggggccaacggtggccctggaaggcagccat
        V  K  A  Q  L  G  P  T  V  A  L  E  G  S  H 
   4446 cttggctatgggcggaagttttcttcagagaccgagggacgggaa
        L  G  Y  G  R  K  F  S  S  E  T  E  G  R  E 
   4491 tccgttgccgcccccggccgggcggcacgaccccgatttgggtat
        S  V  A  A  P  G  R  A  A  R  P  R  F  G  Y 
   4536 aggagagaggagcgtgggaactggcggacccccatacccgtaacc
        R  R  E  E  R  G  N  W  R  T  P  I  P  V  T 
   4581 ccgggcgcccgccagcggcgcagctcgcgccaattccaggggacc
        P  G  A  R  Q  R  R  S  S  R  Q  F  Q  G  T 
   4626 agtgtgtgccaggcggccgcgatgggtggcgccatggtcctgctc
        S  V  C  Q  A  A  A  M  G  G  A  M  V  L  L 
   4671 tatgccagccgggcctgctacaacctgacagcactggccttggcc
        Y  A  S  R  A  C  Y  N  L  T  A  L  A  L  A 
   4716 ccccagagccggctggacaccttcgattacgactggtacaatgtg
        P  Q  S  R  L  D  T  F  D  Y  D  W  Y  N  V 
   4761 tctgaccaggccgtgctggaacccgggcctcagccgcagccgcag
        S  D  Q  A  V  L  E  P  G  P  Q  P  Q  P  Q 
   4806 cggggccgagtgtgcacgctagtgtccacacacgtgtgcgtgggc
        R  G  R  V  C  T  L  V  S  T  H  V  C  V  G 
   4851 tctgggtgccctggcgcggccggcacgcccatgggggccggggat
        S  G  C  P  G  A  A  G  T  P  M  G  A  G  D 
   4896 gccggggcgtctgcggagagtgcaggtgtgacgacagctccccag
        A  G  A  S  A  E  S  A  G  V  T  T  A  P  Q 
   4941 gagccccccgcccggcccctccaggcgggcagtggagctggcccg
        E  P  P  A  R  P  L  Q  A  G  S  G  A  G  P 
   4986 gcgcctgggcgcgccatgcgcagcaccacgctcctggccctgctg
        A  P  G  R  A  M  R  S  T  T  L  L  A  L  L 
   5031 gcgctggtcttgctttacttggtgtctggtgccctggtgttccgg
        A  L  V  L  L  Y  L  V  S  G  A  L  V  F  R 
   5076 gccctggagcagccccacgagcagcaggcccagagggagctgggg
        A  L  E  Q  P  H  E  Q  Q  A  Q  R  E  L  G 
   5121 gaggtccgagagaagttcctgagggcccatccgtgtgtgagcgac
        E  V  R  E  K  F  L  R  A  H  P  C  V  S  D 
   5166 caggagctgggcctcctcatcaagaggtggctgatgccctgggag
        Q  E  L  G  L  L  I  K  R  W  L  M  P  W  E 
   5211 ggggtgcggacccagaaaccaactcgaccagcaacagcagccact
        G  V  R  T  Q  K  P  T  R  P  A  T  A  A  T 
   5256 cagcctgggacctgggcagcgccttctttttctcagggaccatca
        Q  P  G  T  W  A  A  P  S  F  S  Q  G  P  S 
   5301 tcaccaccatcggtgggggaggggattggcatgtggggggcggca
        S  P  P  S  V  G  E  G  I  G  M  W  G  A  A 
   5346 aggagcttcctcatgggggaaggtgcagggagacggaggggtccc
        R  S  F  L  M  G  E  G  A  G  R  R  R  G  P 
   5391 aggtggcccctagacttcctgcatcgcccctctgcccaggctatg
        R  W  P  L  D  F  L  H  R  P  S  A  Q  A  M 
   5436 gcaatgtggccctgcgcacagatgccgggcgcctcttctgcatct
        A  M  W  P  C  A  Q  M  P  G  A  S  S  A  S 
   5481 tttatgcgctggtggggattccgctgtttgggatcctactggcag
        F  M  R  W  W  G  F  R  C  L  G  S  Y  W  Q 
   5526 gggtcggggaccggctgggctcctccctgcgccatggcatcggtc
        G  S  G  T  G  W  A  P  P  C  A  M  A  S  V 
   5571 acattgaagccatcttctttgggtccgttggggcagaaccatgga
        T  L  K  P  S  S  L  G  P  L  G  Q  N  H  G 
   5616 ggaaaagccttcgaaccagaaaagtcttcctcaatgtcatcactc
        G  K  A  F  E  P  E  K  S  S  S  M  S  S  L 
   5661 aatattgcgaagcacatgccccatcgagcctactgggcagagcag
        N  I  A  K  H  M  P  H  R  A  Y  W  A  E  Q 
   5706 cagagcggtagaggtctcccgcgggcggggagggggaggcgtagc
        Q  S  G  R  G  L  P  R  A  G  R  G  R  R  S 
   5751 aactttaggcaacttcccaaaggtgtgcgcaggttgggggcggga
        N  F  R  Q  L  P  K  G  V  R  R  L  G  A  G 
   5796 cgcggcgccccgggaggtggcggcctctgcgacagcgggagtata
        R  G  A  P  G  G  G  G  L  C  D  S  G  S  I 
   5841 agagtggacctgcaggctggtcgcgaggaggtggagcggcgcccg
        R  V  D  L  Q  A  G  R  E  E  V  E  R  R  P 
   5886 ccgtgtgcctgggaccggcatgctggggcaggagggcagccgcgt
        P  C  A  W  D  R  H  A  G  A  G  G  Q  P  R 
   5931 gtccaccaagcggagacgcaaggcctgccaggcctgccgcttcac
        V  H  Q  A  E  T  Q  G  L  P  G  L  P  L  H 
   5976 caagtgcctgcgggtgggcatgctcaaggagaggagtgcgcctgg
        Q  V  P  A  G  G  H  A  Q  G  E  E  C  A  W 
   6021 accgcgtccggggtgggcggcagaagtacaagcggcggccggagg
        T  A  S  G  V  G  G  R  S  T  S  G  G  R  R 
   6066 tggacccactgcccttcccgggccccttccctgctgggcccctgg
        W  T  H  C  P  S  R  A  P  S  L  L  G  P  W 
   6111 cagtcgctggcagcagccccagtgaatgcactggtgtctcatctg
        Q  S  L  A  A  A  P  V  N  A  L  V  S  H  L 
   6156 ctggtggttgagcctgagaagctctatgccatgcctgaccccgca
        L  V  V  E  P  E  K  L  Y  A  M  P  D  P  A 
   6201 ggccctgatgggcacctcccagccgtggctaccctctgtgacctc
        G  P  D  G  H  L  P  A  V  A  T  L  C  D  L 
   6246 tttgaccgagagattgtggtcaccatcagctgggccaagagcatc
        F  D  R  E  I  V  V  T  I  S  W  A  K  S  I 
   6291 ccaaggaggcggagtggaagtggccgtggggcgggtatgggacta
        P  R  R  R  S  G  S  G  R  G  A  G  M  G  L 
   6336 gctggcgtgtgcgccctgagacgctcagcgggctatatactcgtc
        A  G  V  C  A  L  R  R  S  A  G  Y  I  L  V 
   6381 ggtggggccggcggtcagtctgcggcagcggcagcaagacggtac
        G  G  A  G  G  Q  S  A  A  A  A  A  R  R  Y 
   6426 agtgaaggagagtgggcgtctggcggggtccgcagtttcagcaga
        S  E  G  E  W  A  S  G  G  V  R  S  F  S  R 
   6471 gccgctgcagccatggccccaatcacagacacacctgccagggtt
        A  A  A  A  M  A  P  I  T  D  T  P  A  R  V 
   6516 tgtggagcaggctga 6530   
        C  G  A  G  * 



  Homo sapiens (man) [primates] taxid 9606
 dbj|BAG58791.1| unnamed protein product [Homo sapiens]            263  2e-80
 pdb|3UM7|A Chain A, Crystal Structure Of The Human Two Por...     175  4e-46
 pdb|3UM7|B Chain B, Crystal Structure Of The Human Two Por...     175  4e-46
 gb|AAF64062.1|AF247042_1 tandem pore domain potassium chan...     173  3e-44
 gb|AAK49390.1|AF259501_1 two pore K+ channel KT4.1b [Homo ...     172  3e-44
 gb|EAW74241.1| hCG1810791, isoform CRA_a [Homo sapiens]           172  3e-44
 gb|AAI10328.1| KCNK4 protein [Homo sapiens]                       145  2e-34
 pdb|3D24|A Chain A, Crystal Structure Of Ligand-Binding Do...     125  1e-28
 pdb|3D24|C Chain C, Crystal Structure Of Ligand-Binding Do...     125  1e-28
 ref|NP_201567.1| potassium channel subfamily K member 4 pr...     126  3e-28
 sp|Q9NYG8.2|KCNK4_HUMAN RecName: Full=Potassium channel su...     126  3e-28
 gb|AAG31731.1|AF248242_1 2P domain potassium channel [Homo...     126  3e-28
 gb|AAK49389.1|AF259500_1 two pore K+ channel KT4.1a [Homo ...     126  3e-28
 gb|EAW74242.1| hCG1810791, isoform CRA_b [Homo sapiens]           126  3e-28
 gb|EAW74243.1| hCG1810791, isoform CRA_b [Homo sapiens]           126  3e-28
 gb|ACH86094.1| K2P4.1 potassium channel [Homo sapiens]            126  3e-28
 pdb|3K6P|A Chain A, Estrogen Related Receptor Alpha In Com...     122  8e-28
 pdb|1XB7|A Chain A, X-Ray Structure Of Erralpha Lbd In Com...     122  9e-28
 gb|AAH33701.1| Similar to estrogen-related receptor alpha,...     122  2e-27
 gb|AAH07915.2| ESRRA protein [Homo sapiens]                       122  2e-27
 gb|EAW74247.1| hCG2016877, isoform CRA_c [Homo sapiens]           122  5e-27
 ref|NP_004442.3| steroid hormone receptor ERR1 [Homo sapiens]     122  1e-26
 sp|P11474.3|ERR1_HUMAN RecName: Full=Steroid hormone recep...     122  1e-26
 gb|AAH92470.1| ESRRA protein [Homo sapiens]                       122  1e-26
 gb|AAH93722.1| Estrogen-related receptor alpha [Homo sapiens]     122  1e-26
 gb|AAH93720.1| Estrogen-related receptor alpha [Homo sapiens]     122  1e-26
 gb|ABF47104.1| estrogen-related receptor alpha [Homo sapiens]     122  1e-26
 gb|EAW74246.1| hCG2016877, isoform CRA_b [Homo sapiens]           122  1e-26
 gb|EAW74250.1| hCG2016877, isoform CRA_b [Homo sapiens]           122  1e-26
 gb|AAH63795.2| Estrogen-related receptor alpha [Homo sapiens]     122  1e-26
 gb|ADZ17378.1| estrogen-related nuclear receptor alpha [Ho...     122  1e-26
 pdb|2PJL|A Chain A, Crystal Structure Of Human Estrogen-Re...     118  2e-26
 pdb|2PJL|B Chain B, Crystal Structure Of Human Estrogen-Re...     118  2e-26
 gb|EAW74245.1| hCG2016877, isoform CRA_a [Homo sapiens]           120  3e-26
 emb|CAA35778.1| unnamed protein product [Homo sapiens]            121  3e-26
 prf||1402310A cryptic steroid hormone receptor 1                  121  3e-26
 gb|AAB17015.1| estrogen receptor-related protein, partial ...     120  5e-26
 sp|P30044.4|PRDX5_HUMAN RecName: Full=Peroxiredoxin-5, mit...     108  2e-23
 ref|NP_857635.1| peroxiredoxin-5, mitochondrial isoform c ...     104  7e-23
 gb|AAI71733.1| Peroxiredoxin 5 [Homo sapiens]                     104  7e-23
 ref|NP_001170829.1| integral membrane protein GPR137 isofo...     108  7e-23
 dbj|BAH13657.1| unnamed protein product [Homo sapiens]            108  7e-23
 ref|NP_001164351.1| integral membrane protein GPR137 isofo...     108  1e-22
 gb|AAH33920.1| GPR137 protein [Homo sapiens]                      108  1e-22
 gb|EAW74240.1| G protein-coupled receptor 137, isoform CRA...     108  1e-22
 gb|EAW74237.1| G protein-coupled receptor 137, isoform CRA...     108  2e-22
 ref|NP_857634.1| peroxiredoxin-5, mitochondrial isoform b ...     104  2e-22
 gb|AAI43850.1| Peroxiredoxin 5 [Homo sapiens]                     104  2e-22
 ref|NP_064540.3| integral membrane protein GPR137 isoform ...     108  2e-22
 sp|Q96N19.2|G137A_HUMAN RecName: Full=Integral membrane pr...     108  2e-22
 gb|EAW74239.1| G protein-coupled receptor 137, isoform CRA...     108  3e-22
 gb|AAF04856.1|AF197952_1 thioredoxin peroxidase PMP20 [Hom...     104  4e-22
 ref|NP_001164197.1| integral membrane protein GPR137 isofo...     108  5e-22
 dbj|BAG61979.1| unnamed protein product [Homo sapiens]            108  5e-22
 ref|NP_001164197.1| integral membrane protein GPR137 isofo...      52  3e-04
 dbj|BAG61979.1| unnamed protein product [Homo sapiens]             52  3e-04
 ref|NP_036226.1| peroxiredoxin-5, mitochondrial isoform a ...     104  5e-22
 gb|AAF03750.1|AF110731_1 antioxidant enzyme B166 [Homo sap...     104  5e-22
 gb|AAF78899.1|AF231705_1 Alu co-repressor 1 [Homo sapiens]        104  5e-22
 gb|AAF99605.1|AF242525_1 hypothetical protein SBBI10 [Homo...     104  5e-22
 emb|CAG33484.1| PRDX5 [Homo sapiens]                              104  5e-22
 gb|ABB05181.1| peroxiredoxin 5 [Homo sapiens]                     104  5e-22
 gb|AAI10984.1| Peroxiredoxin 5 [Homo sapiens]                     104  5e-22
 gb|AAI13726.1| Peroxiredoxin 5 [Homo sapiens]                     104  5e-22
 gb|AAI13724.1| Peroxiredoxin 5 [Homo sapiens]                     104  5e-22
 dbj|BAB71093.1| unnamed protein product [Homo sapiens]            104  5e-21


Ref: PMCID: PMC3329120
Crystal structure of the human K2P TRAAK, a lipid- and mechano-sensitive K+ ion channel
Stephen G. Brohawn, Josefina del Marmol, and Roderick MacKinnon
Science. 2012 January 27; 335(6067): 436–441. doi: 10.1126/science.1213808



Ref: PMCID: PMC3342347
Acute Lung Injury: How Macrophages Orchestrate Resolution of Inflammation and Tissue Repair
Susanne Herold,1, Konstantin Mayer, and Juergen Lohmeyer
Front Immunol. 2011; 2: 65. doi: 10.3389/fimmu.2011.00065



Ref: PMCID: 18219526
Peroxiredoxin V contributes to antioxidant defense of lung epithelial cells
Avila PC, Kropotov AV, Krutilina R, Krasnodembskay A, Tomilin NV, Serikov VB.
Lung. 2008 Mar-Apr;186(2):103-14. Epub 2008 Jan 25.



Ref: PMCID: 16781710
Peroxiredoxin V is essential for protection against apoptosis in human lung carcinoma cells
Kropotov A, Gogvadze V, Shupliakov O, Tomilin N, Serikov VB, Tomilin NV, Zhivotovsky B.
Exp Cell Res. 2006 Sep 10;312(15):2806-15. Epub 2006 May 17.



Ref: PMCID: 16326404
Cigarette smoke extract inhibits expression of peroxiredoxin V and increases airway epithelial permeability
Serikov VB, Leutenegger C, Krutilina R, Kropotov A, Pleskach N, Suh JH, Tomilin NV.
Inhal Toxicol. 2006 Jan;18(1):79-92.