A single CEL file (N01_normal.CEL from prostate normal):

NM_001031834 Homo sapiens RAB40A, member RAS oncogene family-like (RAB40AL), mRNA




   4929 atgttctatgctaatttctcaagaagaacaggcccggcaccacct
        M  F  Y  A  N  F  S  R  R  T  G  P  A  P  P 
   4884 ctgcgcacaaccccgcgggcctggctcaggcgggagtgcggggcc
        L  R  T  T  P  R  A  W  L  R  R  E  C  G  A 
   4839 agcaccatgagcgccccgggcagccccgaccaggcctatgacttc
        S  T  M  S  A  P  G  S  P  D  Q  A  Y  D  F 
   4794 ctgctcaagttcctgctggtgggcgacagggacgtaggcaagagt
        L  L  K  F  L  L  V  G  D  R  D  V  G  K  S 
   4749 gagatcctggagagcctgcaggatggtgcagctgagtccccgtac
        E  I  L  E  S  L  Q  D  G  A  A  E  S  P  Y 
   4704 agccatctcggggggatcgactacaagacgaccaccatcctgctg
        S  H  L  G  G  I  D  Y  K  T  T  T  I  L  L 
   4659 gacggccagcgggtgaagctgaagctctgggatacgtcggggcag
        D  G  Q  R  V  K  L  K  L  W  D  T  S  G  Q 
   4614 ggaagattttgtaccatattccgctcctactctcgtggtgcacaa
        G  R  F  C  T  I  F  R  S  Y  S  R  G  A  Q 
   4569 ggagtgatcctggtctacgacattgcaaaccgctggtctttcgag
        G  V  I  L  V  Y  D  I  A  N  R  W  S  F  E 
   4524 ggtatggatcgatggattaagaagattgaggaacatgcccctggt
        G  M  D  R  W  I  K  K  I  E  E  H  A  P  G 
   4479 gtccctaaaatcctggtggggaatcgcctacatctggcattcaag
        V  P  K  I  L  V  G  N  R  L  H  L  A  F  K 
   4434 aggcaggtgcccagggagcaggcccaggcctacgccgagcgcctg
        R  Q  V  P  R  E  Q  A  Q  A  Y  A  E  R  L 
   4389 ggtgtgaccttctttgaggtcagccctctgtgcaatttcaacatc
        G  V  T  F  F  E  V  S  P  L  C  N  F  N  I 
   4344 atagagtctttcacggagctggccaggatagtgctgctgcggcac
        I  E  S  F  T  E  L  A  R  I  V  L  L  R  H 
   4299 aggatgaattggctcgggaggccgagcaaggtactgagcttgcaa
        R  M  N  W  L  G  R  P  S  K  V  L  S  L  Q 
   4254 gacctctgctgccgcaccatcgtgtcctgcacacctgtgcatctg
        D  L  C  C  R  T  I  V  S  C  T  P  V  H  L 
   4209 gtggacaagctcccgctccccagtaccttaagaagccacctcaag
        V  D  K  L  P  L  P  S  T  L  R  S  H  L  K 
   4164 tccttctccatggctaagggcctgaatgccaggatgatgcgaggc
        S  F  S  M  A  K  G  L  N  A  R  M  M  R  G 
   4119 ctctcctactccctcaccaccagctccactcacaagagcagcctc
        L  S  Y  S  L  T  T  S  S  T  H  K  S  S  L 
   4074 tgcaaagtggagatcgtctgcccaccccagagcccacccaaaaac
        C  K  V  E  I  V  C  P  P  Q  S  P  P  K  N 
   4029 tgcaccagaaacagctgcaaaatttcttaa 4000   
        C  T  R  N  S  C  K  I  S  * 


XP_001137221.2 PREDICTED: ras-related protein Rab-40A isoform 1 [Pan troglodytes]

NP_543155.2 ras-related protein Rab-40A [Homo sapiens]
>sp|Q8WXH6.2|RB40A_HUMAN RecName: Full=Ras-related protein Rab-40A; AltName: Full=SOCS box-containing protein RAR2A; Short=Protein Rar-2; Flags: Precursor
>gb|AAL75949.1|AF132748_1 Rar-2 protein [Homo sapiens]
>gb|AAH74854.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAH74855.1| RAB40A, member RAS oncogene family [Homo sapiens]
>emb|CAI41993.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAI17233.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAI13502.1| RAB40A, member RAS oncogene family [Homo sapiens]
>dbj|BAF02899.1| Rab40A [Homo sapiens]
>gb|EAW54708.1| RAB40A, member RAS oncogene family, isoform CRA_b [Homo sapiens]
>dbj|BAG74194.1| RAB40A, member RAS oncogene family [synthetic construct]
>gb|ADR82904.1| RAB40A, member RAS oncogene family (RAB40A) [synthetic construct]


     39 atgttacttcagaaccctcaactggcttatgctttgctgcaagca
        M  L  L  Q  N  P  Q  L  A  Y  A  L  L  Q  A 
     84 caggtagtgatgagaattgtggatccggaaattgccctggtccca
        Q  V  V  M  R  I  V  D  P  E  I  A  L  V  P 
    129 gtcatgcagggaacaggaatgcaaggagcaagtatacagggtgga
        V  M  Q  G  T  G  M  Q  G  A  S  I  Q  G  G 
    174 agccagcctggcggctttagtcccgggcagaaccaagtcactcca
        S  Q  P  G  G  F  S  P  G  Q  N  Q  V  T  P 
    219 caggatcatgagaagggttttcaaaaatacctggcaagaaatctg
        Q  D  H  E  K  G  F  Q  K  Y  L  A  R  N  L 
    264 gaaattctataa 275    
        E  I  L  * 


EAX02819.1 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, isoform CRA_b [Homo sapiens]

BAG62297.1 unnamed protein product [Homo sapiens]

AAH33135.1 Similar to cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD, partial [Homo sapiens]

NP_001316.1 cleavage stimulation factor subunit 2 [Homo sapiens]
>ref|XP_003317595.1| PREDICTED: cleavage stimulation factor subunit 2 isoform 1 [Pan troglodytes]
>sp|P33240.1|CSTF2_HUMAN RecName: Full=Cleavage stimulation factor subunit 2; AltName: Full=CF-1 64 kDa subunit; AltName: Full=Cleavage stimulation factor 64 kDa subunit; Short=CSTF 64 kDa subunit; Short=CstF-64
>gb|AAA35724.1| cleavage stimulation factor [Homo sapiens]
>gb|AAH17712.1| Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>gb|AAP88780.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>emb|CAI42680.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>emb|CAB06072.2| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>gb|AAX41742.1| cleavage stimulation factor 3' pre-RNA subunit 2 [synthetic construct]
>gb|AAX41743.1| cleavage stimulation factor 3' pre-RNA subunit 2 [synthetic construct]
>gb|EAX02818.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, isoform CRA_a [Homo sapiens]
>gb|ABM82458.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [synthetic construct]
>gb|ABM85647.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [synthetic construct]
>dbj|BAI46582.1| Cleavage stimulation factor 64 kDa subunit [synthetic construct]